Accessibility navigation

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Lists
Tools

Leal, R. M. F., Callow, S., Callow, P., Blakeley, M. P., Cardin, C. J. ORCID: https://orcid.org/0000-0002-2556-9995, Denny, W. A., Teixeira, S. C. M., Mitchell, E. P. and Forsyth, V. T. (2010) Combined neutron and X-ray diffraction studies of DNA in crystals and solutions. Acta Crystallographica Section D Biological Crystallography, 66 (11). pp. 1244-1248. ISSN 1399-0047

Full text not archived in this repository.

It is advisable to refer to the publisher's version if you intend to cite from this work. See Guidance on citing.

To link to this item DOI: 10.1107/S0907444910017713

Abstract/Summary

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Item Type:Article
Refereed:Yes
Divisions:Life Sciences > School of Chemistry, Food and Pharmacy > Department of Chemistry
ID Code:16153
Uncontrolled Keywords:neutron diffraction;X-ray diffraction;nucleic acids;DNA;acridine derivatives;deuteration;SAXS;SANS
Publisher:John Wiley & Sons for the International Union of Crystallography
Altmetric
Related URLs
Deposit Details

University Staff: Request a correction | Centaur Editors: Update this record

Page navigation

See also